Sequence retrieval

Genome: Listeria innocua Clip11262
Start position: 2710888
End position: 2710911
Length: 24

DNA sequence
>NC_003212, from 2710888 to 2710911 (24 bp); Listeria innocua Clip11262 TAAAACAAAAAAACAATAAAACTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2709463-2710956	Sequence	lin2693 - hypothetical protein (Protein is coded in complementary strand; from 2710956 to 2709463)