Sequence retrieval

Genome: Listeria innocua Clip11262
Start position: 2391893
End position: 2391916
Length: 24

DNA sequence
>NC_003212, from 2391893 to 2391916 (24 bp); Listeria innocua Clip11262 CAGAATCAAAATCATAATCAGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2391559-2392080	Sequence	lin2358 - hypothetical protein (Protein is coded in complementary strand; from 2392080 to 2391559)