Sequence retrieval

Genome: Listeria innocua Clip11262
Start position: 2081228
End position: 2081258
Length: 31

DNA sequence
>NC_003212, from 2081228 to 2081258 (31 bp); Listeria innocua Clip11262 CAATGAAGCCCAATTAAGTCAAATGAAGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2080544-2081854	Sequence	lin2066 - hypothetical protein (Protein is coded in complementary strand; from 2081854 to 2080544)