Sequence retrieval

Genome: Listeria innocua Clip11262
Start position: 2070416
End position: 2070460
Length: 45

DNA sequence
>NC_003212, from 2070416 to 2070460 (45 bp); Listeria innocua Clip11262 AGCAGCTTTGTCTGCAGCGGCCTTCTCTGCGGCAGCTTTTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2070192-2070923	Sequence	lin2055 - hypothetical protein (Protein is coded in complementary strand; from 2070923 to 2070192)