Sequence retrieval

Genome: Listeria innocua Clip11262
Start position: 1925407
End position: 1925444
Length: 38

DNA sequence
>NC_003212, from 1925407 to 1925444 (38 bp); Listeria innocua Clip11262 GCATCCGCATCGGCATCCGCATCGGCATCTGCATCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1923973-1926621	Sequence	lin1913 - peptidoglycan binding protein (Protein is coded in complementary strand; from 1926621 to 1923973)