Sequence retrieval

Genome: Listeria innocua Clip11262
Start position: 2152056
End position: 2152088
Length: 33

DNA sequence
>NC_003212, from 2152056 to 2152088 (33 bp); Listeria innocua Clip11262 TTTGTTTAATGTTTCTTCAATGTTTGTAAAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2151736-2152263	Sequence	lin2128 - hypothetical protein (Protein is coded in complementary strand; from 2152263 to 2151736)