Sequence retrieval

Genome: Listeria innocua Clip11262
Start position: 2725695
End position: 2725721
Length: 27

DNA sequence
>NC_003212, from 2725695 to 2725721 (27 bp); Listeria innocua Clip11262 TCTTCATCTTCATCGTCATCATCATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2725494-2726030	Sequence	lin2705 - DNA-directed RNA polymerase subunit delta (Protein is coded in complementary strand; from 2726030 to 2725494)