Sequence retrieval

Genome: Wolbachia endosymbiont of Drosophila melanogaster
Start position: 1243846
End position: 1243881
Length: 36

DNA sequence
>NC_002978, from 1243846 to 1243881 (36 bp); Wolbachia endosymbiont of Drosophila melanogaster ATTTCATCATCTATTTCACCATCCACTTCATAATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1243810-1244217	Sequence	WD1303 rpoZ DNA-directed RNA polymerase, omega subunit (Protein is coded in complementary strand; from 1244217 to 1243810)