Sequence retrieval

Genome: Wolbachia endosymbiont of Drosophila melanogaster
Start position: 1088642
End position: 1088677
Length: 36

DNA sequence
>NC_002978, from 1088642 to 1088677 (36 bp); Wolbachia endosymbiont of Drosophila melanogaster CCTTTCTCTATACCTTTTTGTATACCTTTCTCTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1088519-1089289	Sequence	WD1137 - hypothetical protein (Protein is coded in complementary strand; from 1089289 to 1088519)