Sequence retrieval

Genome: Wolbachia endosymbiont of Drosophila melanogaster
Start position: 252289
End position: 252318
Length: 30

DNA sequence
>NC_002978, from 252289 to 252318 (30 bp); Wolbachia endosymbiont of Drosophila melanogaster TAAAAAGTCAAAAAAAGTGAGAAGAAGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 250515-252341	Sequence	WD0265 - prophage LambdaW1, terminase large subunit