Sequence retrieval

Genome: Wolbachia endosymbiont of Drosophila melanogaster
Start position: 657648
End position: 657674
Length: 27

DNA sequence
>NC_002978, from 657648 to 657674 (27 bp); Wolbachia endosymbiont of Drosophila melanogaster CCTTAACTTCCTTGACTTCCTTGACTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 657644-657973	Sequence	WD0682 rpsJ 30S ribosomal protein S10 (Protein is coded in complementary strand; from 657973 to 657644)