Sequence retrieval

Genome: Listeria monocytogenes str. 4b F2365
Start position: 557389
End position: 557416
Length: 28

DNA sequence
>NC_002973, from 557389 to 557416 (28 bp); Listeria monocytogenes str. 4b F2365 GATTTTCAGAAAAAGCAAATCTTAAGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 555585-557414	Sequence	LMOf2365_0543 - cell wall surface anchor family protein