Sequence retrieval

Genome: Treponema denticola ATCC 35405
Start position: 408489
End position: 408512
Length: 24

DNA sequence
>NC_002967, from 408489 to 408512 (24 bp); Treponema denticola ATCC 35405 TTTTTATTTTCATCTTTATTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 407591-409534	Sequence	TDE0362 - Ig-like protein (Protein is coded in complementary strand; from 409534 to 407591)