Sequence retrieval

Genome: Treponema denticola ATCC 35405
Start position: 32589
End position: 32612
Length: 24

DNA sequence
>NC_002967, from 32589 to 32612 (24 bp); Treponema denticola ATCC 35405 TTTGATTTTTTAATTTTTCGATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 31916-33106	Sequence	TDE0026 - TraB (Protein is coded in complementary strand; from 33106 to 31916)