Sequence retrieval

Genome: Treponema denticola ATCC 35405
Start position: 2278224
End position: 2278269
Length: 46

DNA sequence
>NC_002967, from 2278224 to 2278269 (46 bp); Treponema denticola ATCC 35405 TGCTTTTTTAGGTTCTATTTTTTTGGGTTCCGCCTTTTTAGGTACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2277715-2278512	Sequence	TDE2240 - hypothetical protein (Protein is coded in complementary strand; from 2278512 to 2277715)