Sequence retrieval

Genome: Treponema denticola ATCC 35405
Start position: 1942587
End position: 1942612
Length: 26

DNA sequence
>NC_002967, from 1942587 to 1942612 (26 bp); Treponema denticola ATCC 35405 GGATGCGGAGGCGGCTGCGGATGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1942120-1942665	Sequence	TDE1925 - FKBP-type peptidyl-prolyl cis-trans isomerase