Sequence retrieval

Genome: Treponema denticola ATCC 35405
Start position: 1940326
End position: 1940349
Length: 24

DNA sequence
>NC_002967, from 1940326 to 1940349 (24 bp); Treponema denticola ATCC 35405 AAAGAAATAAGAAATAAGAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1940008-1940367	Sequence	TDE1920 - lipoprotein (Protein is coded in complementary strand; from 1940367 to 1940008)