Sequence retrieval

Genome: Treponema denticola ATCC 35405
Start position: 1835745
End position: 1835774
Length: 30

DNA sequence
>NC_002967, from 1835745 to 1835774 (30 bp); Treponema denticola ATCC 35405 TATTTAATTATATTTACTTTTATTTTATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1835745-1836362	Sequence	TDE1797 - hypothetical protein (Protein is coded in complementary strand; from 1836362 to 1835745)