Sequence retrieval

Genome: Treponema denticola ATCC 35405
Start position: 1309187
End position: 1309210
Length: 24

DNA sequence
>NC_002967, from 1309187 to 1309210 (24 bp); Treponema denticola ATCC 35405 AAACTAATACTAAAATTAAAATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1308733-1309650	Sequence	TDE1274 - oligopeptide/dipeptide ABC transporter permease (Protein is coded in complementary strand; from 1309650 to 1308733)