Sequence retrieval

Genome: Treponema denticola ATCC 35405
Start position: 2798325
End position: 2798359
Length: 35

DNA sequence
>NC_002967, from 2798325 to 2798359 (35 bp); Treponema denticola ATCC 35405 AATATTATCTAAATATTATCTAAATATTATCTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2797810-2798337	Sequence	TDE2743 - type I restriction-modification system, S subunit, truncation
ORF... 2798345-2799943	Sequence	TDE2744 hsdS type I restriction-modification system subunit S (Protein is coded in complementary strand; from 2799943 to 2798345)