Sequence retrieval

Genome: Treponema denticola ATCC 35405
Start position: 1769527
End position: 1769559
Length: 33

DNA sequence
>NC_002967, from 1769527 to 1769559 (33 bp); Treponema denticola ATCC 35405 AAACAAAGAAAAACCAAGAGAAAAATAGAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1768573-1769586	Sequence	TDE1714 - N-acetylmuramoyl-L-alanine amidase (Protein is coded in complementary strand; from 1769586 to 1768573)