Sequence retrieval

Genome: Treponema denticola ATCC 35405
Start position: 261616
End position: 261645
Length: 30

DNA sequence
>NC_002967, from 261616 to 261645 (30 bp); Treponema denticola ATCC 35405 TTATTTTTATCTATTTTTTTTAATTTTGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 260956-262836	Sequence	TDE0229 - ATPase (Protein is coded in complementary strand; from 262836 to 260956)