Sequence retrieval

Genome: Treponema denticola ATCC 35405
Start position: 253661
End position: 253690
Length: 30

DNA sequence
>NC_002967, from 253661 to 253690 (30 bp); Treponema denticola ATCC 35405 ATAAAATTTTTTAAAATTATATAGAATCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 253446-253934	Sequence	TDE0219 - hypothetical protein (Protein is coded in complementary strand; from 253934 to 253446)