Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 2711312
End position: 2711385
Length: 74

DNA sequence
>NC_002951, from 2711312 to 2711385 (74 bp); Staphylococcus aureus subsp. aureus COL GAGTCTGAGTCGCTATCTGAGTCTGAATCGCTGTCTGAGTCTGAGTCGCTATCCGAGTCTGAGTCGCTGT CTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2711036-2713777	Sequence	SACOL2652 clfB clumping factor B (Protein is coded in complementary strand; from 2713777 to 2711036)