Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 107658
End position: 107729
Length: 72

DNA sequence
>NC_002951, from 107658 to 107729 (72 bp); Staphylococcus aureus subsp. aureus COL CCATCTTCTTTACCAGGTTTGTTGCCATCTTCTTTGCCAGGCTTGTTGCCGTCTTCTTTACCAGGTTTTT TG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 107364-108890	Sequence	SACOL0095 spa immunoglobulin G binding protein A precursor (Protein is coded in complementary strand; from 108890 to 107364)