Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 60766
End position: 60821
Length: 56

DNA sequence
>NC_002951, from 60766 to 60821 (56 bp); Staphylococcus aureus subsp. aureus COL GATTCAGATGCGGACAGCGATTCAGACGCAGATAGCGATTCTGATGCAGACAGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 57212-61858	Sequence	SACOL0050 pls methicillin-resistant surface protein