Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 61099
End position: 61152
Length: 54

DNA sequence
>NC_002951, from 61099 to 61152 (54 bp); Staphylococcus aureus subsp. aureus COL GCAGATAGCGATTCAGACGCAGATAGCGACTCAGACGCAGATAGCGATTCAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 57212-61858	Sequence	SACOL0050 pls methicillin-resistant surface protein