Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 1435137
End position: 1435187
Length: 51

DNA sequence
>NC_002951, from 1435137 to 1435187 (51 bp); Staphylococcus aureus subsp. aureus COL ATTTTTTGTCTTCAGACTTTTTATCATCAGATTTCTTGTCGTCTGATTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1435136-1436119	Sequence	SACOL1424 - phosphate ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 1436119 to 1435136)