Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 2426408
End position: 2426454
Length: 47

DNA sequence
>NC_002951, from 2426408 to 2426454 (47 bp); Staphylococcus aureus subsp. aureus COL TTATTATTCGCTTGGTTATTACTTGATTGGTTATTATTTGTTTGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2426087-2426716	Sequence	SACOL2365 - hypothetical protein (Protein is coded in complementary strand; from 2426716 to 2426087)