Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 2736591
End position: 2736627
Length: 37

DNA sequence
>NC_002951, from 2736591 to 2736627 (37 bp); Staphylococcus aureus subsp. aureus COL TGGATCTTCCGATGTATCTTTCGATGCATCTTTCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2735299-2737206	Sequence	SACOL2668 - LPXTG cell wall surface anchor family protein (Protein is coded in complementary strand; from 2737206 to 2735299)