Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 1147516
End position: 1147546
Length: 31

DNA sequence
>NC_002951, from 1147516 to 1147546 (31 bp); Staphylococcus aureus subsp. aureus COL CTTTAACTTCTTTAACTTCTTTAGCTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1145889-1147826	Sequence	SACOL1138 isdB LPXTG cell wall surface anchor protein (Protein is coded in complementary strand; from 1147826 to 1145889)