Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 2250667
End position: 2250696
Length: 30

DNA sequence
>NC_002951, from 2250667 to 2250696 (30 bp); Staphylococcus aureus subsp. aureus COL CATGTATCTTGATGCATCTTCAGGTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2250059-2251252	Sequence	SACOL2170 - transporter (Protein is coded in complementary strand; from 2251252 to 2250059)