Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 1567844
End position: 1567873
Length: 30

DNA sequence
>NC_002951, from 1567844 to 1567873 (30 bp); Staphylococcus aureus subsp. aureus COL TTTTGTTTCTGTATTTGTTTCTGTATTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1567020-1567898	Sequence	SACOL1530 - hypothetical protein (Protein is coded in complementary strand; from 1567898 to 1567020)