Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 1063067
End position: 1063094
Length: 28

DNA sequence
>NC_002951, from 1063067 to 1063094 (28 bp); Staphylococcus aureus subsp. aureus COL TCAGGGTTGTTAGGGTTGTCAGGGTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1063016-1064026	Sequence	SACOL1057 sspA V8 protease (Protein is coded in complementary strand; from 1064026 to 1063016)