Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 1762914
End position: 1762940
Length: 27

DNA sequence
>NC_002951, from 1762914 to 1762940 (27 bp); Staphylococcus aureus subsp. aureus COL TTCTTTTTTTATCTTTTCTATTCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1762066-1762986	Sequence	SACOL1731 dnaI primosomal protein DnaI (Protein is coded in complementary strand; from 1762986 to 1762066)