Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 1069662
End position: 1069688
Length: 27

DNA sequence
>NC_002951, from 1069662 to 1069688 (27 bp); Staphylococcus aureus subsp. aureus COL TAGGTGTTGGTGTAGGCGTAGGTTTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1067693-1071463	Sequence	SACOL1062 atl bifunctional autolysin (Protein is coded in complementary strand; from 1071463 to 1067693)