Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 2351578
End position: 2351603
Length: 26

DNA sequence
>NC_002951, from 2351578 to 2351603 (26 bp); Staphylococcus aureus subsp. aureus COL ACAATAACTATAACAATTACAACAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2351332-2352135	Sequence	SACOL2291 - staphyloxanthin biosynthesis protein