Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 1894864
End position: 1894889
Length: 26

DNA sequence
>NC_002951, from 1894864 to 1894889 (26 bp); Staphylococcus aureus subsp. aureus COL TTTTTTCTTTCTTTTTTTATTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1894859-1895344	Sequence	SACOL1839 - IS200 family transposase (Protein is coded in complementary strand; from 1895344 to 1894859)