Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 1274194
End position: 1274219
Length: 26

DNA sequence
>NC_002951, from 1274194 to 1274219 (26 bp); Staphylococcus aureus subsp. aureus COL TATAGAATTATATAATTATAGAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1274121-1275365	Sequence	SACOL1265 eprH endopeptidase resistance gene