Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 2440526
End position: 2440550
Length: 25

DNA sequence
>NC_002951, from 2440526 to 2440550 (25 bp); Staphylococcus aureus subsp. aureus COL TTTAAATTAATTTTATGTAATATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2440454-2440576	Sequence	SACOL2380 - hypothetical protein (Protein is coded in complementary strand; from 2440576 to 2440454)