Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 2079759
End position: 2079783
Length: 25

DNA sequence
>NC_002951, from 2079759 to 2079783 (25 bp); Staphylococcus aureus subsp. aureus COL TCTGGATCTGGTTTTGGATCCGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2078943-2080202	Sequence	SACOL2019 - sdrH protein (Protein is coded in complementary strand; from 2080202 to 2078943)