Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 902878
End position: 902901
Length: 24

DNA sequence
>NC_002951, from 902878 to 902901 (24 bp); Staphylococcus aureus subsp. aureus COL AAAAGTATAAAAGTTTAAAAGAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 902527-903348	Sequence	SACOL0884 - ABC transporter substrate-binding protein