Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 479271
End position: 479294
Length: 24

DNA sequence
>NC_002951, from 479271 to 479294 (24 bp); Staphylococcus aureus subsp. aureus COL GGAAAATAGCAAAATAGAAAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 478598-479809	Sequence	SACOL0477 - type I restriction-modification system S subunit