Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus COL
Start position: 1387891
End position: 1387914
Length: 24

DNA sequence
>NC_002951, from 1387891 to 1387914 (24 bp); Staphylococcus aureus subsp. aureus COL CTGCTTCTTCTTCGGCTTCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1387830-1388192	Sequence	SACOL1383 mscL large-conductance mechanosensitive channel (Protein is coded in complementary strand; from 1388192 to 1387830)