Sequence retrieval

Genome: Pseudomonas putida KT2440
Start position: 4907897
End position: 4907924
Length: 28

DNA sequence
>NC_002947, from 4907897 to 4907924 (28 bp); Pseudomonas putida KT2440 GTTGCCGTTGCCGTTGCCGTTGCCGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4907826-4908023	Sequence	PP_4317 - hypothetical protein (Protein is coded in complementary strand; from 4908023 to 4907826)