Sequence retrieval

Genome: Pseudomonas putida KT2440
Start position: 3453918
End position: 3453949
Length: 32

DNA sequence
>NC_002947, from 3453918 to 3453949 (32 bp); Pseudomonas putida KT2440 TCAGCTCTTCAGCTCTTCAGCTCTTCAGCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3453935-3455887	Sequence	PP_3071 - acetoacetyl-CoA synthetase (Protein is coded in complementary strand; from 3455887 to 3453935)