Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 2658724
End position: 2658784
Length: 61

DNA sequence
>NC_002927, from 2658724 to 2658784 (61 bp); Bordetella bronchiseptica GGCATGGTCGTGCCCGGCATGGTCATGGCCTGCGTGGTCGTGGCCTGCGTGGTCGTGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2656511-2658847	Sequence	BB2504 - membrane transport ATPase (Protein is coded in complementary strand; from 2658847 to 2656511)