Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 3243336
End position: 3243381
Length: 46

DNA sequence
>NC_002927, from 3243336 to 3243381 (46 bp); Bordetella bronchiseptica GGCGCCAGGCATCTGGCCGCTGGGCATCTGGCCGCTGGGCATCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3243274-3243843	Sequence	BB3039 - hypothetical protein (Protein is coded in complementary strand; from 3243843 to 3243274)