Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 4603689
End position: 4603733
Length: 45

DNA sequence
>NC_002927, from 4603689 to 4603733 (45 bp); Bordetella bronchiseptica TCACCGCGTCGATGATCAGCGCGTTGGTGATCACCGTGTCGACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4602224-4603939	Sequence	BB4323 ureC urease subunit alpha (Protein is coded in complementary strand; from 4603939 to 4602224)