Sequence retrieval

Genome: Bordetella bronchiseptica
Start position: 3480169
End position: 3480213
Length: 45

DNA sequence
>NC_002927, from 3480169 to 3480213 (45 bp); Bordetella bronchiseptica GCCTCGTCGGCGCCGGCTTCGCCGGCGGCGGCCGCGTCGCCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3478618-3480399	Sequence	BB3249 - hypothetical protein (Protein is coded in complementary strand; from 3480399 to 3478618)